Jonah-1
(Plasmid
#228899)
-
PurposeJonah-1 localizes to the outer cyst wall of Acanthamoeba tagged with eGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228899 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGAPDH
- Backbone size w/o insert (bp) 5803
- Total vector size (bp) 7411
-
Vector typeAcanthamoeba expression vector
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameJonah-1
-
Alt nameUncharacterized protein
-
SpeciesAcanthamoeba castellanii Neff
-
Mutationnone
-
GenBank IDXM_004337565.1
- Promoter Own promoter
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer ATGAAGACCACCTACCTGCTGCTCGCTCTCGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Jonah-1 was a gift from John Samuelson (Addgene plasmid # 228899 ; http://n2t.net/addgene:228899 ; RRID:Addgene_228899) -
For your References section:
Cellulose binding and the timing of expression influence protein targeting to the double-layered cyst wall of Acanthamoeba. Kanakapura Sundararaj B, Goyal M, Samuelson J. mSphere. 2024 Sep 25;9(9):e0046624. doi: 10.1128/msphere.00466-24. Epub 2024 Aug 13. 10.1128/msphere.00466-24 PubMed 39136454