Skip to main content

CamKII-mtPyronicSF
(Plasmid #228906)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228906 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5132
  • Total vector size (bp) 6737
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pyronic SF
  • Alt name
    Pyruvate Optical Nano-Indicator from CECs Single-Fluorophore
  • Species
    Synthetic
  • Insert Size (bp)
    1605
  • Promoter CamKII
  • Tag / Fusion Protein
    • Cox8 targetting (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggatccacccgccaccccatgtccgtcctgacgc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://pubmed.ncbi.nlm.nih.gov/38562794/ for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CamKII-mtPyronicSF was a gift from Ghazaleh Ashrafi (Addgene plasmid # 228906 ; http://n2t.net/addgene:228906 ; RRID:Addgene_228906)
  • For your References section:

    Mitochondrial pyruvate transport regulates presynaptic metabolism and neurotransmission. Tiwari A, Myeong J, Hashemiaghdam A, Stunault MI, Zhang H, Niu X, Laramie MA, Sponagel J, Shriver LP, Patti GJ, Klyachko VA, Ashrafi G. Sci Adv. 2024 Nov 15;10(46):eadp7423. doi: 10.1126/sciadv.adp7423. Epub 2024 Nov 15. 10.1126/sciadv.adp7423 PubMed 39546604