CamKII-mtPyronicSF
(Plasmid
#228906)
-
PurposeExpression of mtPyronicSF in neurons targeted to the mitochondria serving as an optical sensor for mitochondrial pyruvate uptake. Backbone from Addgene plasmid 100834
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228906 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5132
- Total vector size (bp) 6737
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepyronic SF
-
Alt namePyruvate Optical Nano-Indicator from CECs Single-Fluorophore
-
SpeciesSynthetic
-
Insert Size (bp)1605
- Promoter CamKII
-
Tag
/ Fusion Protein
- Cox8 targetting (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ggatccacccgccaccccatgtccgtcctgacgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://pubmed.ncbi.nlm.nih.gov/38562794/ for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CamKII-mtPyronicSF was a gift from Ghazaleh Ashrafi (Addgene plasmid # 228906 ; http://n2t.net/addgene:228906 ; RRID:Addgene_228906) -
For your References section:
Mitochondrial pyruvate transport regulates presynaptic metabolism and neurotransmission. Tiwari A, Myeong J, Hashemiaghdam A, Stunault MI, Zhang H, Niu X, Laramie MA, Sponagel J, Shriver LP, Patti GJ, Klyachko VA, Ashrafi G. Sci Adv. 2024 Nov 15;10(46):eadp7423. doi: 10.1126/sciadv.adp7423. Epub 2024 Nov 15. 10.1126/sciadv.adp7423 PubMed 39546604