Skip to main content

pCDH-CB-Cdkn1a
(Plasmid #228914)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228914 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDH-CB
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cdkn1a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    480
  • Entrez Gene
    Cdkn1a (a.k.a. CAP20, CDKI, CIP1, Cdkn1, P21, SDI1, Waf1, mda6, p21Cip1, p21WAF)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggatccatgtccaatcctgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-CB-Cdkn1a was a gift from Sika Zheng (Addgene plasmid # 228914 ; http://n2t.net/addgene:228914 ; RRID:Addgene_228914)
  • For your References section:

    Epistatic interactions between NMD and TRP53 control progenitor cell maintenance and brain size. Lin L, Zhao J, Kubota N, Li Z, Lam YL, Nguyen LP, Yang L, Pokharel SP, Blue SM, Yee BA, Chen R, Yeo GW, Chen CW, Chen L, Zheng S. Neuron. 2024 Jul 3;112(13):2157-2176.e12. doi: 10.1016/j.neuron.2024.04.006. Epub 2024 May 1. 10.1016/j.neuron.2024.04.006 PubMed 38697111