E547* FL USP7
(Plasmid
#229001)
-
PurposeE547-mutant of human USP7
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229001 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a-LIC
-
Backbone manufacturerStructural Genomics Consortium, Toronto
- Backbone size w/o insert (bp) 7328
- Total vector size (bp) 10634
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameUSP7 1-546
-
Alt nameUbiquitin carboxyl-terminal hydrolase 7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3306
-
MutationE547 mutated to stop codon
-
Entrez GeneUSP7 (a.k.a. C16DELp13.2, DEL16P13.2, HAFOUS, HAUSP, TEF1)
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis cleavable with thrombin (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 5’ AATTAATACGACTCACTATAGGG 3’
- 3′ sequencing primer T7-term 5’ ATGCTAGTTATTGCTCAGCGG 3’
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
E547* FL USP7 was a gift from Irina Bezsonova (Addgene plasmid # 229001 ; http://n2t.net/addgene:229001 ; RRID:Addgene_229001)