Bidirectional MYC 5'UTR Dual Fluorescence Reporter
(Plasmid
#229498)
-
PurposeThis is a lentiviral reporter for translation initiation under the control of the Myc 5'UTR, which produces destabilized GFP (dsGFP). There is a control destabilized mCherry (dsmCherry) as a control.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 229498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLV EF1a hPGK mCherry
- Total vector size (bp) 11496
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMYC 5'Untranslated region + destabilized GFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1254
- Promoter Ef1a
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Bidirectional MYC 5'UTR Dual Fluorescence Reporter was a gift from Davide Ruggero (Addgene plasmid # 229498 ; http://n2t.net/addgene:229498 ; RRID:Addgene_229498) -
For your References section:
Functional screen identifies RBM42 as a mediator of oncogenic mRNA translation specificity. Kovalski JR, Sarioglu G, Subramanyam V, Hernandez G, Rademaker G, Oses-Prieto JA, Slota M, Mohan N, Yiakis K, Liu I, Wen KW, Kim GE, Miglani S, Burlingame AL, Goodarzi H, Perera RM, Ruggero D. Nat Cell Biol. 2025 Feb 4. doi: 10.1038/s41556-024-01604-7. 10.1038/s41556-024-01604-7 PubMed 39905246