Skip to main content

pCDF-RFP amber
(Plasmid #229524)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229524 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDF
  • Backbone size w/o insert (bp) 3494
  • Total vector size (bp) 4208
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RFP amber
  • Alt name
    mCherry
  • Species
    Discosoma sp.
  • Insert Size (bp)
    714
  • Promoter T7

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDF-RFP amber was a gift from Thomas Huber (Addgene plasmid # 229524 ; http://n2t.net/addgene:229524 ; RRID:Addgene_229524)
  • For your References section:

    Biosynthesis and genetic encoding of activated nitriles for fast protein conjugation and tunable fluorogenic labeling. Abdelkader EH, Qianzhu H, Otting G, Huber T. Chem 102385 10.1016/j.chempr.2024.12.003