pCDF-RFP amber
              
              
                (Plasmid
                
                #229524)
              
            
            
            
          - 
            PurposemCherry red fluorescent protein (RFP) reporter protein with an amber stop codon at position 13
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229524 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCDF
- Backbone size w/o insert (bp) 3494
- Total vector size (bp) 4208
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Spectinomycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberLow Copy
Gene/Insert
- 
                Gene/Insert nameRFP amber
- 
                  Alt namemCherry
- 
                    SpeciesDiscosoma sp.
- 
                  Insert Size (bp)714
- Promoter T7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pCDF-RFP amber was a gift from Thomas Huber (Addgene plasmid # 229524 ; http://n2t.net/addgene:229524 ; RRID:Addgene_229524)
- 
                For your References section: Biosynthesis and genetic encoding of activated nitriles for fast protein conjugation and tunable fluorogenic labeling. Abdelkader EH, Qianzhu H, Otting G, Huber T. Chem 102385 10.1016/j.chempr.2024.12.003
