Skip to main content

Rab11 single guide RNA
(Plasmid #229683)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229683 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX459
  • Backbone manufacturer
    Feng Zhang, Addgene plasmid #62988
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab11 guide
  • gRNA/shRNA sequence
    CGTCGCGGGTGCCCATTGCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    RAB11A (a.k.a. YL8)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Rab11 single guide RNA was a gift from Francesca Bottanelli (Addgene plasmid # 229683 ; http://n2t.net/addgene:229683 ; RRID:Addgene_229683)
  • For your References section:

    ARF1 compartments direct cargo flow via maturation into recycling endosomes. Stockhammer A, Adarska P, Natalia V, Heuhsen A, Klemt A, Bregu G, Harel S, Rodilla-Ramirez C, Spalt C, Ozsoy E, Leupold P, Grindel A, Fox E, Mejedo JO, Zehtabian A, Ewers H, Puchkov D, Haucke V, Bottanelli F. Nat Cell Biol. 2024 Oct 4. doi: 10.1038/s41556-024-01518-4. 10.1038/s41556-024-01518-4 PubMed 39367144