Rab11 single guide RNA
(Plasmid
#229683)
-
Purposeguide RNA for Rab11 tagging at the N-terminus in pX459
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX459
-
Backbone manufacturerFeng Zhang, Addgene plasmid #62988
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab11 guide
-
gRNA/shRNA sequenceCGTCGCGGGTGCCCATTGCG
-
SpeciesH. sapiens (human)
-
Entrez GeneRAB11A (a.k.a. YL8)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Rab11 single guide RNA was a gift from Francesca Bottanelli (Addgene plasmid # 229683 ; http://n2t.net/addgene:229683 ; RRID:Addgene_229683) -
For your References section:
ARF1 compartments direct cargo flow via maturation into recycling endosomes. Stockhammer A, Adarska P, Natalia V, Heuhsen A, Klemt A, Bregu G, Harel S, Rodilla-Ramirez C, Spalt C, Ozsoy E, Leupold P, Grindel A, Fox E, Mejedo JO, Zehtabian A, Ewers H, Puchkov D, Haucke V, Bottanelli F. Nat Cell Biol. 2024 Oct 4. doi: 10.1038/s41556-024-01518-4. 10.1038/s41556-024-01518-4 PubMed 39367144