Skip to main content

fabp10a:CreERT2; cryaa:mCerulean
(Plasmid #230044)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 230044 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pBlueScript
  • Vector type
    Cre/Lox ; Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CreERT2
  • Species
    Bacteriophage P1
  • Insert Size (bp)
    2004
  • Promoter fabp10a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gtcgtcaaatcctggtgcaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.01.09.629100 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    fabp10a:CreERT2; cryaa:mCerulean was a gift from Sumeet Pal Singh (Addgene plasmid # 230044 ; http://n2t.net/addgene:230044 ; RRID:Addgene_230044)
  • For your References section:

    Cholangiocytes contribute to hepatocyte regeneration after partial liver injury during growth spurt in zebrafish. Eski SE, Mi J, Pozo-Morales M, Hovhannisyan GG, Perazzolo C, Manco R, Ez-Zammoury I, Barbhaya D, Lefort A, Libert F, Marini F, Gurzov EN, Andersson O, Singh SP. Nat Commun. 2025 Jun 6;16(1):5260. doi: 10.1038/s41467-025-60334-y. 10.1038/s41467-025-60334-y PubMed 40480975