fabp10a:GCaMP6s; cryaa:mCherry
(Plasmid
#230060)
-
PurposeExpression of genetically encoded calcium indicator in zebrafish hepatocytes.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 230060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBlueScript
-
Vector typeZebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6s
-
SpeciesSynthetic
-
Insert Size (bp)1353
- Promoter fabp10a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gtcgtcaaatcctggtgcaa
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNikolay Ninov. GCaMP6s obtained from ins:GCaMP6s; cryaa:RFP (Addgene Plasmid #110285).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
fabp10a:GCaMP6s; cryaa:mCherry was a gift from Sumeet Pal Singh (Addgene plasmid # 230060 ; http://n2t.net/addgene:230060 ; RRID:Addgene_230060) -
For your References section:
In vivo imaging of calcium dynamics in zebrafish hepatocytes. Pozo-Morales M, Garteizgogeascoa I, Perazzolo C, So J, Shin D, Singh SP. Hepatology. 2023 Mar 1;77(3):789-801. doi: 10.1002/hep.32663. Epub 2023 Feb 17. 10.1002/hep.32663 PubMed 35829917