pCAG-GluA2-Fab-HC-Halo
(Plasmid
#230061)
-
PurposeExpresses heavy chain Fab fragment of anti-GluA2 fused to HaloTag. Can be used with light chain to produce Fab in HEK cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 230061 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4625
- Total vector size (bp) 6600
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnti-GluA2 Fab heavy chain fragment
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1846
- Promoter Chicken beta actin (CAG)
-
Tag
/ Fusion Protein
- HaloTag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tagagcctctgctaaccatg
- 3′ sequencing primer acgcacaccggccttat
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-GluA2-Fab-HC-Halo was a gift from Matthew Kennedy (Addgene plasmid # 230061 ; http://n2t.net/addgene:230061 ; RRID:Addgene_230061)