Skip to main content

fabp10a:lox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR2.0; cmlc2:EGFP
(Plasmid #230075)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 230075 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC57
  • Vector type
    Cre/Lox ; Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR2.0
  • Alt name
    BB-NTR2.0
  • Species
    D. rerio (zebrafish); Aequorea victoria, Entacmaea quadricolor, Discosoma sp., Vibrio vulnificus
  • Insert Size (bp)
    4642
  • GenBank ID
    AAV52164 OP373690.1
  • Promoter fabp10a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gtcgtcaaatcctggtgcaa
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Jeff Mumm: Sequence for NTR 2.0 was obtained from 5xUAS:GAP-mCherry-P2A-NfsB_Vv F70A/F108Y,he:tagBFP2 (Addgene Plasmid #158653). This sequence was used to synthesize the insert.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.05.23.655316 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    fabp10a:lox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR2.0; cmlc2:EGFP was a gift from Sumeet Pal Singh (Addgene plasmid # 230075 ; http://n2t.net/addgene:230075 ; RRID:Addgene_230075)
  • For your References section:

    CellCousin2: An Optimized System for Partial Ablation and Tracing of Regenerative Lineages. Hovhannisyan GG, Akhourbi T, Eski SE, Pirson I, Gurzov EN, Singh SP. bioRxiv 2025.05.23.655316 10.1101/2025.05.23.655316