Skip to main content
Addgene

fabp10a:DD-CreER; cryaa:mCerulean
(Plasmid #230076)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 230076 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pBlueScript
  • Vector type
    Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ltDHFR(DD)
  • Alt name
    folA dihydrofolate reductase ( destable domain) for low temperature (zebrafish codon optimized)
  • Species
    Synthetic; E. coli
  • Insert Size (bp)
    2568
  • Mutation
    amino acids mutations: R12H, N23S, G67S, V78A, E120G, E134G, E153V, E157G
  • GenBank ID
    AAC73159
  • Promoter fabp10a
  • Tags / Fusion Proteins
    • CreER (C terminal on insert)
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gtcgtcaaatcctggtgcaa
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Thomas Wandless. Sequence for DD was obtained from pBMN ltDHFR(DD)-YFP (Addgene Plasmid #47076), which is mutant #21 published in Cho et al., PLoS One. 2013 Aug 22;8(8):e72393. doi: 10.1371/journal.pone.0072393. We utilized this sequence and generated a zebrafish codon optimized version. This sequence was synthesized, along with CreER to give a DD-CreER sequence.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.05.23.655316 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    fabp10a:DD-CreER; cryaa:mCerulean was a gift from Sumeet Pal Singh (Addgene plasmid # 230076 ; http://n2t.net/addgene:230076 ; RRID:Addgene_230076)
  • For your References section:

    CellCousin2: An Optimized System for Partial Ablation and Tracing of Regenerative Lineages. Hovhannisyan GG, Akhourbi T, Eski SE, Pirson I, Gurzov EN, Singh SP. bioRxiv 2025.05.23.655316 10.1101/2025.05.23.655316