pRSFDuet-1 ElonginB, ElonginC
(Plasmid
#230999)
-
PurposeDual expression vector containing mouse ElonginB and ElonginC for E.coli protein purification
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 230999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSF Duet-1
-
Backbone manufacturerSigma-Aldrich
- Backbone size w/o insert (bp) 3829
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameElongin B
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)357
-
Entrez GeneElob (a.k.a. 0610040H15Rik, Tceb2)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site Sal1 (unknown if destroyed)
- 5′ sequencing primer GGATCTCGACGCTCTCCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameElongin C
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)337
-
Entrez GeneEloc (a.k.a. 2610043E24Rik, 2610301I15Rik, Tceb1)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GCTAGTTATTGCTCAGCGGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSFDuet-1 ElonginB, ElonginC was a gift from Michael Rape (Addgene plasmid # 230999 ; http://n2t.net/addgene:230999 ; RRID:Addgene_230999) -
For your References section:
A Cellular Mechanism to Detect and Alleviate Reductive Stress. Manford AG, Rodriguez-Perez F, Shih KY, Shi Z, Berdan CA, Choe M, Titov DV, Nomura DK, Rape M. Cell. 2020 Oct 1;183(1):46-61.e21. doi: 10.1016/j.cell.2020.08.034. Epub 2020 Sep 16. 10.1016/j.cell.2020.08.034 PubMed 32941802