Skip to main content

pET-30a-L6KD-PT linker-PEP-Mtu ΔI-CM-xylanase
(Plasmid #231128)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231128 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET30a
  • Backbone size w/o insert (bp) 5237
  • Total vector size (bp) 7275
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    xylanase
  • Insert Size (bp)
    1218
  • Promoter T7
  • Tag / Fusion Protein
    • cSAT2.0 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Gene encoded xylanase was from Yoon et al. Biochem Mol Biol Int. 1998;45:337–47.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-30a-L6KD-PT linker-PEP-Mtu ΔI-CM-xylanase was a gift from Xiaofeng Yang (Addgene plasmid # 231128 ; http://n2t.net/addgene:231128 ; RRID:Addgene_231128)
  • For your References section:

    A high-performance protein preparation approach in a single column-free step. Huang Y, Zhang Y, Yang X, Lin Z. Trends Biotechnol. 2024 Nov 12:S0167-7799(24)00290-7. doi: 10.1016/j.tibtech.2024.10.008. 10.1016/j.tibtech.2024.10.008 PubMed 39537535