pET-30a-L6KD-PT linker-PEP-Mtu ΔI-CM-xylanase
(Plasmid
#231128)
-
PurposeExpresses xylanase via a cSAT2.0 scheme
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET30a
- Backbone size w/o insert (bp) 5237
- Total vector size (bp) 7275
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namexylanase
-
Insert Size (bp)1218
- Promoter T7
-
Tag
/ Fusion Protein
- cSAT2.0 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGene encoded xylanase was from Yoon et al. Biochem Mol Biol Int. 1998;45:337–47.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-30a-L6KD-PT linker-PEP-Mtu ΔI-CM-xylanase was a gift from Xiaofeng Yang (Addgene plasmid # 231128 ; http://n2t.net/addgene:231128 ; RRID:Addgene_231128) -
For your References section:
A high-performance protein preparation approach in a single column-free step. Huang Y, Zhang Y, Yang X, Lin Z. Trends Biotechnol. 2024 Nov 12:S0167-7799(24)00290-7. doi: 10.1016/j.tibtech.2024.10.008. 10.1016/j.tibtech.2024.10.008 PubMed 39537535