mCherry-pHluorin-His
(Plasmid
#231546)
-
PurposeExpresses an mCherry-pHluorin fusion protein in bacteria, with His tag.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 4776
- Total vector size (bp) 6213
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry-pHluorin
-
Insert Size (bp)1437
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Other
- 5′ sequencing primer atggtttcaaaaggcgaagaag
- 3′ sequencing primer tttgtatagttcatcca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-pHluorin-His was a gift from David O'Connor (Addgene plasmid # 231546 ; http://n2t.net/addgene:231546 ; RRID:Addgene_231546)