pCaggs-mGold2t
(Plasmid
#231764)
-
PurposeExpression of mGold2t in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCaggs
- Backbone size w/o insert (bp) 6105
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemGold2t
-
Alt namemGold(V1A;V22I;H77N;Q80R;K101E;D117G; I123V;S147C;Y151F;K156R;K158Q;A163V;D173V;S205T;G232S)
-
Alt namemVenus(V1A;V22I;L46F;T63S;H77N;Q80R;K101E;D117G; I123V;S147C;Y151F;K156R;K158Q;A163V;D173V;S205T;G232S)
-
SpeciesSynthetic
-
Insert Size (bp)720
-
MutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D117G; I123V;S147C;Y151F;K156R;K158Q;A163V;D173V;S205T;G232S mutations
- Promoter Actin promoter with CMV enhancer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer aaggtggtggctggtgtggc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCaggs-mGold2t was a gift from Francois St-Pierre (Addgene plasmid # 231764 ; http://n2t.net/addgene:231764 ; RRID:Addgene_231764) -
For your References section:
Bright and photostable yellow fluorescent proteins for extended imaging. Lee J, Lai S, Yang S, Zhao S, Blanco FA, Lyons AC, Merino-Urteaga R, Ahrens JF, Nguyen NA, Liu H, Liu Z, Lambert GG, Shaner NC, Chen L, Tolias KF, Zhang J, Ha T, St-Pierre F. Nat Commun. 2025 Apr 4;16(1):3241. doi: 10.1038/s41467-025-58223-5. 10.1038/s41467-025-58223-5 PubMed 40185748