pBFC1171
(Plasmid
#231994)
-
PurposeCRISPRi-ART crRNA only plasmid encoding crystal violet-inducible crRNA (for dRfxCas13d) with 2xBsaI spacer cloning site
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231994 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneSC101
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecrRNA of dRfxCas13d
-
gRNA/shRNA sequenceAGAGACCTCGTTTACCTATCGGTCTC
-
SpeciesRuminococcus flavefaciens
- Promoter pJEx (Jungle Express)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer N/A
- 3′ sequencing primer N/A
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.09.18.558157 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBFC1171 was a gift from Brady Cress (Addgene plasmid # 231994 ; http://n2t.net/addgene:231994 ; RRID:Addgene_231994) -
For your References section:
CRISPRi-ART enables functional genomics of diverse bacteriophages using RNA-binding dCas13d. Adler BA, Al-Shimary MJ, Patel JR, Armbruster EG, Colognori D, Charles EJ, Miller KV, Lahiri A, Cui ML, Oromi-Bosch A, Voelker A, Trinidad M, Lee J, Beurnier S, Boger R, Nomburg J, Barrangou R, Mutalik VK, Schoeniger JS, Pogliano JA, Savage DF, Doudna JA, Cress BF. Nat Microbiol. 2025 Mar;10(3):694-709. doi: 10.1038/s41564-025-01935-7. Epub 2025 Feb 26. 10.1038/s41564-025-01935-7 PubMed 40011704