Skip to main content

pBFC1171
(Plasmid #231994)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231994 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    SC101
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    crRNA of dRfxCas13d
  • gRNA/shRNA sequence
    AGAGACCTCGTTTACCTATCGGTCTC
  • Species
    Ruminococcus flavefaciens
  • Promoter pJEx (Jungle Express)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.09.18.558157 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBFC1171 was a gift from Brady Cress (Addgene plasmid # 231994 ; http://n2t.net/addgene:231994 ; RRID:Addgene_231994)
  • For your References section:

    CRISPRi-ART enables functional genomics of diverse bacteriophages using RNA-binding dCas13d. Adler BA, Al-Shimary MJ, Patel JR, Armbruster EG, Colognori D, Charles EJ, Miller KV, Lahiri A, Cui ML, Oromi-Bosch A, Voelker A, Trinidad M, Lee J, Beurnier S, Boger R, Nomburg J, Barrangou R, Mutalik VK, Schoeniger JS, Pogliano JA, Savage DF, Doudna JA, Cress BF. Nat Microbiol. 2025 Mar;10(3):694-709. doi: 10.1038/s41564-025-01935-7. Epub 2025 Feb 26. 10.1038/s41564-025-01935-7 PubMed 40011704