pcDNA-mCherry-TAG-EGFP
(Plasmid
#232156)
-
PurposeA fluorescence reporter to show incorporation of target unnatural amino acids.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-linker(TAG)-EGFP
-
SpeciesSynthetic
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-mCherry-TAG-EGFP was a gift from Nanxi Wang (Addgene plasmid # 232156 ; http://n2t.net/addgene:232156 ; RRID:Addgene_232156) -
For your References section:
Genetic code expansion reveals site-specific lactylation in living cells reshapes protein functions. Shao C, Tang S, Yu S, Liu C, Zhang Y, Wan T, He Z, Yuan Q, Wu S, Zhang H, Wan N, Zhan M, Tan RX, Hao H, Ye H, Wang N. Nat Commun. 2025 Jan 8;16(1):227. doi: 10.1038/s41467-024-55165-2. 10.1038/s41467-024-55165-2 PubMed 39779673