Tol2-mfap4-BFP
(Plasmid
#232188)
-
Purposemacrophage-specific promoter driving BFP in a Tol2 backbone for expression in zebrafish
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232188 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTol2
- Backbone size w/o insert (bp) 3100
-
Vector typeZebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBFP
-
Insert Size (bp)696
- Promoter mfap4
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgccattttgtctcgtattg
- 3′ sequencing primer GTGGTTTGTCCAAACTCATCA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymfap4 promoter amplified from p5E-mfap4 (Addgene catalog no. 70052, a gift from David Tobin) BFP promoter amplified from Tol2-lyz-BFP (PMID 30071103)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tol2-mfap4-BFP was a gift from Emily Rosowski (Addgene plasmid # 232188 ; http://n2t.net/addgene:232188 ; RRID:Addgene_232188) -
For your References section:
Glucocorticoids Suppress NF-kappaB-Mediated Neutrophil Control of Aspergillus fumigatus Hyphal Growth. Thrikawala SU, Anderson MH, Rosowski EE. J Immunol. 2024 Oct 1;213(7):971-987. doi: 10.4049/jimmunol.2400021. 10.4049/jimmunol.2400021 PubMed 39178124