Skip to main content

pAAV-CA-FLEX-dtA
(Plasmid #232236)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232236 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-CA-flex
  • Backbone manufacturer
    Uchida lab (Harvard)
  • Backbone size w/o insert (bp) 6058
  • Total vector size (bp) 6058
  • Modifications to backbone
    The dtA gene was inserted at EcoRV site
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Diphtheria toxin A subunit
  • Alt name
    dtA
  • Species
    Corynebacterium ulcerans
  • Insert Size (bp)
    778
  • GenBank ID
    AB610405.1
  • Promoter CA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (destroyed during cloning)
  • 3′ cloning site SacI (destroyed during cloning)
  • 5′ sequencing primer gcagaatggtagctggattg
  • 3′ sequencing primer ccagaggttgattatcgataagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Philippe Soriano, PGKdtabpA from Addgene Plasmid #13440
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.02.05.479267 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CA-FLEX-dtA was a gift from Naoshige Uchida (Addgene plasmid # 232236 ; http://n2t.net/addgene:232236 ; RRID:Addgene_232236)
  • For your References section:

    Dopamine in the tail of the striatum facilitates avoidance in threat-reward conflicts. Tsutsui-Kimura I, Tian ZM, Amo R, Zhuo Y, Li Y, Campbell MG, Uchida N, Watabe-Uchida M. Nat Neurosci. 2025 Apr;28(4):795-810. doi: 10.1038/s41593-025-01902-9. Epub 2025 Mar 10. 10.1038/s41593-025-01902-9 PubMed 40065189