mEtfdh CRISPR_2
(Plasmid
#232313)
-
PurposeMouse Etfdh Gene Knockout (gRNA 2)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 232313 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneLentiCRISPRv2GFP
-
Vector typeLentiviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEtfdh-targeting gRNA
-
Alt nameEtfqo
-
gRNA/shRNA sequenceAAACACCTCTGTGTGCTCCAAGATC
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)23
-
Entrez GeneEtfdh (a.k.a. 0610010I20Rik)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site N/A (unknown if destroyed)
- 5′ sequencing primer N/A (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.10.25.620155 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mEtfdh CRISPR_2 was a gift from Ivan Topisirovic (Addgene plasmid # 232313 ; http://n2t.net/addgene:232313 ; RRID:Addgene_232313) -
For your References section:
Mitochondrial ETF insufficiency drives neoplastic growth by selectively optimizing cancer bioenergetics. Papadopoli D, Palia R, Jovanovic P, Tabariès S, Ciccolini E, Sabourin V, Igelmann S, McLaughlan S, Zhan L, Kim H, Chekkal N, Szkop KJ, Bertomeu T, Zeng J, Vassalakis J, Afzali F, Mzoughi S, Guccione E, Tyers M, Avizonis D, Larsson O, Postovit LM, Djuranovic S, Ursini-Siegel J, Siegel PM, Pollak M, Topisirovic I. bioRxiv 2024.10.25.620155 10.1101/2024.10.25.620155