Skip to main content

pSJX022
(Plasmid #232325)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232325 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBXMCS2
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    sgRNA
  • Alt name
    spmX
  • Alt name
    Lysozyme-family localization factor spmX
  • Species
    Caulobacter crescentus
  • Promoter PJ23119
  • Tag / Fusion Protein
    • H-arms (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    SpCas9M
  • Promoter Pvan
  • Tag / Fusion Protein
    • cat (C terminal on insert)

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sgRNA sequence: tctcttgatgagatcgacgg

Please visit https://doi.org/10.1101/2024.12.02.626314 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSJX022 was a gift from Wei Zhao (Addgene plasmid # 232325 ; http://n2t.net/addgene:232325 ; RRID:Addgene_232325)
  • For your References section:

    A CRISPR-SpCas9M-reporting system for efficient and rapid genome editing in Caulobacter crescentus. Sun J, Yu X, Tang G, Chen M, Zheng Y, Hu Y, Li Q, Li X, Li N, Li Z, Li Y, Lu N, Tan W, Yang Y, Lyu X, Zhao G, Wang H, Dai L, Zhao GP, Ai L, Zhao W. Nucleic Acids Res. 2025 Apr 22;53(8):gkaf353. doi: 10.1093/nar/gkaf353. 10.1093/nar/gkaf353 PubMed 40298107
Commonly requested with: