pHR-TetOn-mCherry-OAZ1_FS-YFP
(Plasmid
#232356)
-
PurposeMammalian expression of dox-inducible polyamine sensor (polyamine levels = YFP/Cherry)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersmCherry after doxycycline induction
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameOAZ1 derived polyamine sensing module
-
Alt nameOAZ1_FS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)170
-
GenBank IDNM_004152.3
-
Entrez GeneOAZ1 (a.k.a. AZ1, AZI, OAZ)
- Promoter TRE3G
-
Tags
/ Fusion Proteins
- mCherry (N terminal on insert)
- eYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGACGAGCTGTACAAGGGCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.08.24.609500 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-TetOn-mCherry-OAZ1_FS-YFP was a gift from Ankur Jain (Addgene plasmid # 232356 ; http://n2t.net/addgene:232356 ; RRID:Addgene_232356) -
For your References section:
Genetically encoded fluorescent reporter for polyamines. Sharma P, Kim CY, Keys HR, Imada S, Joseph AB, Ferro L, Kunchok T, Anderson R, Yilmaz O, Weng JK, Jain A. bioRxiv [Preprint]. 2024 Nov 17:2024.08.24.609500. doi: 10.1101/2024.08.24.609500. 10.1101/2024.08.24.609500 PubMed 39253442