pCMV_ABE8e–superNLS
(Plasmid
#232429)
-
PurposeExpression plasmid for the ABE8e base editor with superNLS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232429 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBlueScript
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameABE8e–superNLS
-
SpeciesSynthetic; Multiple
- Promoter CMV
Cloning Information
- Cloning method Other
- 5′ sequencing primer CCTCTGCTAACCATGTTCATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV_ABE8e–superNLS was a gift from Gil Westmeyer (Addgene plasmid # 232429 ; http://n2t.net/addgene:232429 ; RRID:Addgene_232429) -
For your References section:
Engineered nucleocytosolic vehicles for loading of programmable editors. Geilenkeuser J, Armbrust N, Steinmassl E, Du SW, Schmidt S, Binder EMH, Li Y, Warsing NW, Wendel SV, von der Linde F, Schiele EM, Niu X, Stroppel L, Berezin O, Santl TH, Orschmann T, Nelson K, Gruber C, Palczewska G, Menezes CR, Risaliti E, Engfer ZJ, Koleci N, Schmidts A, Geerlof A, Palczewski K, Westmeyer GG, Truong DJ. Cell. 2025 May 15;188(10):2637-2655.e31. doi: 10.1016/j.cell.2025.03.015. Epub 2025 Apr 9. 10.1016/j.cell.2025.03.015 PubMed 40209705