EDCPV PCSK5_sg09
(Plasmid
#232455)
-
PurposeLentiviral, CRISPR sgRNA for PCSK5
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232455 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEDCPV
-
Backbone manufacturerRaffaella Sordella, Addgene plasmid #90085
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePCSK5 sgRNA
-
Alt namePC5
-
Alt namePC6
-
gRNA/shRNA sequenceCTACACGGGAAAGAACATTGTGG
-
SpeciesH. sapiens (human)
-
Entrez GenePCSK5 (a.k.a. PC5, PC6, PC6A, SPC6)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EDCPV PCSK5_sg09 was a gift from Kevin Janes (Addgene plasmid # 232455 ; http://n2t.net/addgene:232455 ; RRID:Addgene_232455) -
For your References section:
PCSK5M452I is a recessive hypomorph exclusive to MCF10DCIS.com cells. Marohl T, Atkins KA, Wang L, Janes KA. Mol Cancer Res. 2025 Oct 28. doi: 10.1158/1541-7786.MCR-25-0211. 10.1158/1541-7786.MCR-25-0211 PubMed 41148168