pGPTVII-SED1
(Plasmid
#232615)
-
PurposeSED1 biosensor for expression in Arabidopsis thaliana
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 232615 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGPTVII
- Backbone size w/o insert (bp) 11751
- Total vector size (bp) 13674
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSED1 Biosensor
-
Alt namemCerulean3-AtLEA4-5-Citrine
-
SpeciesSynthetic
-
Insert Size (bp)1923
- Promoter pUBQ10
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgatttgtgatttctatctagatctgg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCesar Cuevas-Velazquez, Jose Dinneny
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGPTVII-SED1 was a gift from Jose Dinneny (Addgene plasmid # 232615 ; http://n2t.net/addgene:232615 ; RRID:Addgene_232615) -
For your References section:
Intrinsically disordered protein biosensor tracks the physical-chemical effects of osmotic stress on cells. Cuevas-Velazquez CL, Vellosillo T, Guadalupe K, Schmidt HB, Yu F, Moses D, Brophy JAN, Cosio-Acosta D, Das A, Wang L, Jones AM, Covarrubias AA, Sukenik S, Dinneny JR. Nat Commun. 2021 Sep 14;12(1):5438. doi: 10.1038/s41467-021-25736-8. 10.1038/s41467-021-25736-8 PubMed 34521831