pIVT-iCre
(Plasmid
#232773)
-
PurposeIVT template for making modRNA encoding iCre
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232773 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 1725
- Total vector size (bp) 3369
-
Vector typeCre/Lox ; in vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiCre
-
SpeciesSynthetic
-
Insert Size (bp)600
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGAAACGCCTGGTATCTTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PCR template for generating linear template for in vitro transcription. 5' and 3' beta globin UTR sequences were based on previous literature for effective modRNA expression in hiPSCs: 10.1016/j.crmeth.2022.100290
The primers used for generating PCR template also came from this work, and are as follows:
FWD: 5’- AGCTATAATACGACTCACTATAAGctcctgggcaacgtgctg-3’, which encodes the T7 promoter compatible with AG CleanCap reagent (upper-case bases) and binds to the 5’ UTR (lower-case bases)
REV: 5’-poly(T)116-GCAATGAAAATAAATGTTTTTTATTAGGCAGAAT-3’}, which encodes the poly(A) tail and binds to the 3’-UTR.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIVT-iCre was a gift from Kate Galloway (Addgene plasmid # 232773 ; http://n2t.net/addgene:232773 ; RRID:Addgene_232773) -
For your References section:
STRAIGHT-IN Dual: a platform for dual, single-copy integrations of DNA payloads and gene circuits into human induced pluripotent stem cells. Blanch-Asensio A, Ploessl DS, Wang NB, Mummery CL, Galloway KE, Davis RP. bioRxiv [Preprint]. 2024 Oct 17:2024.10.17.616637. doi: 10.1101/2024.10.17.616637. 10.1101/2024.10.17.616637 PubMed 39464154