CRBN_ΔHBD
(Plasmid
#232779)
-
PurposeExpresses CRBN_ΔHBD sequence in E. coli cells with cleavable MBP-His tag and deleted internal DDB1 binding domain
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232779 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-28a(+)
-
Backbone manufacturerGenscript
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 7520
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCereblon
-
Alt nameCRBN
-
SpeciesH. sapiens (human)
-
MutationCRBN (residues 47 to 193 and 249 to 436) with GNGNSG
-
Entrez GeneCRBN (a.k.a. MRT2, MRT2A)
- Promoter T7
-
Tag
/ Fusion Protein
- MBP-His6-TEV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenscript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Purchased via gene synthesis and cloning service.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRBN_ΔHBD was a gift from Ivan Dikic (Addgene plasmid # 232779 ; http://n2t.net/addgene:232779 ; RRID:Addgene_232779) -
For your References section:
An engineered cereblon optimized for high throughput screening and molecular glue discovery. Bailey HJ, Eisert J, Kazi R, Gerhartz J, Pienkowska DE, Dressel I, Vollrath J, Kondratov I, Matviyuk T, Tolmachova N, Shah VJ, Giuliani G, Mosler T, Geiger TM, Esteves AM, Santos SP, Sousa RL, Bandeiras TM, Leibrock EM, Bauer U, Leuthner B, Langer JD, Wegener AA, Nowak RP, Sorrell FJ, Dikic I. Cell Chem Biol. 2024 Nov 20:S2451-9456(24)00460-4. doi: 10.1016/j.chembiol.2024.11.002. 10.1016/j.chembiol.2024.11.002 PubMed 39610248