Skip to main content
Addgene

CRBN_ΔHBD
(Plasmid #232779)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232779 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-28a(+)
  • Backbone manufacturer
    Genscript
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 7520
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cereblon
  • Alt name
    CRBN
  • Species
    H. sapiens (human)
  • Mutation
    CRBN (residues 47 to 193 and 249 to 436) with GNGNSG
  • Entrez Gene
    CRBN (a.k.a. MRT2, MRT2A)
  • Promoter T7
  • Tag / Fusion Protein
    • MBP-His6-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Genscript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purchased via gene synthesis and cloning service.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CRBN_ΔHBD was a gift from Ivan Dikic (Addgene plasmid # 232779 ; http://n2t.net/addgene:232779 ; RRID:Addgene_232779)
  • For your References section:

    An engineered cereblon optimized for high throughput screening and molecular glue discovery. Bailey HJ, Eisert J, Kazi R, Gerhartz J, Pienkowska DE, Dressel I, Vollrath J, Kondratov I, Matviyuk T, Tolmachova N, Shah VJ, Giuliani G, Mosler T, Geiger TM, Esteves AM, Santos SP, Sousa RL, Bandeiras TM, Leibrock EM, Bauer U, Leuthner B, Langer JD, Wegener AA, Nowak RP, Sorrell FJ, Dikic I. Cell Chem Biol. 2024 Nov 20:S2451-9456(24)00460-4. doi: 10.1016/j.chembiol.2024.11.002. 10.1016/j.chembiol.2024.11.002 PubMed 39610248