pAAV-CAG-DIO-NES-SomaFRCaMPi
(Plasmid
#232836)
-
PurposeAAV transfer plasmid for CAG-mediated Cre-dependent expression of soma-targeted FRCaMPi
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232836 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNES-FRCaMPi
-
SpeciesSynthetic
-
Insert Size (bp)2085
-
Entrez GeneNES (a.k.a. Nbla00170)
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer GTTATACTAGAATTCGGTACCTAAGCCACCATGCTTCAACTTCCTCCTCTTGAACG
- 3′ sequencing primer AGGGATCCCCTTACTTGTACActaatacagacgctggggcttgcccatg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-DIO-NES-SomaFRCaMPi was a gift from Kiryl Piatkevich (Addgene plasmid # 232836 ; http://n2t.net/addgene:232836 ; RRID:Addgene_232836) -
For your References section:
A sensitive soma-localized red fluorescent calcium indicator for in vivo imaging of neuronal populations at single-cell resolution. Zhou S, Zhu Q, Eom M, Fang S, Subach OM, Ran C, Alvarado JS, Sunkavalli PS, Dong Y, Wang Y, Hu J, Zhang H, Wang Z, Sun X, Yang T, Mu Y, Yoon YG, Guo ZV, Subach FV, Piatkevich KD. PLoS Biol. 2025 Apr 29;23(4):e3003048. doi: 10.1371/journal.pbio.3003048. eCollection 2025 Apr. 10.1371/journal.pbio.3003048 PubMed 40299972