pAAV-CAG-PinkyCaMP
(Plasmid
#232860)
-
PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232860 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-CAG
- Backbone size w/o insert (bp) 4570
- Total vector size (bp) 5995
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePinkyCaMP
-
SpeciesSynthetic
-
Insert Size (bp)1425
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer CCAGGATTTATACAAGGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.16.628673 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-PinkyCaMP was a gift from Olivia Masseck (Addgene plasmid # 232860 ; http://n2t.net/addgene:232860 ; RRID:Addgene_232860) -
For your References section:
PinkyCaMP a mScarlet-based calcium sensor with exceptional brightness, photostability, and multiplexing capabilities. Fink R, Imai S, Gockel N, Lauer G, Renken K, Wietek J, Lamothe-Molina PJ, Furhmann F, Mittag M, Ziebarth T, Canziani A, Kubitschke M, Kistmacher V, Kretschmer A, Sebastian E, Schmitz D, Terai T, Grundemann J, Hassan S, Patriarchi T, Reiner A, Fuhrmann M, Campbell RE, Masseck OA. bioRxiv [Preprint]. 2025 Jan 11:2024.12.16.628673. doi: 10.1101/2024.12.16.628673. 10.1101/2024.12.16.628673 PubMed 39763884