pCoofy1-psHaloTag1a
(Plasmid
#232940)
-
PurposePhotoswichable HaloTag: psHaloTag1a variant
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCoofy1
-
Backbone manufacturerEMBL
- Backbone size w/o insert (bp) 5334
- Total vector size (bp) 6648
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namephotoswitchable HaloTag 1a variant
-
Alt namepsHaloTag1a
-
Insert Size (bp)1371
-
MutationE143W, A258W with linkers L1 (FAG) and L2 (P)
- Promoter T7
-
Tag
/ Fusion Protein
- His6x-HRV3C (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter, forward primer)
- 3′ sequencing primer CTAGTTATTGCTCAGCGGT (T7 terminator, reverse primer)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.18.629107 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCoofy1-psHaloTag1a was a gift from Claire Deo (Addgene plasmid # 232940 ; http://n2t.net/addgene:232940 ; RRID:Addgene_232940) -
For your References section:
A Photoswitchable HaloTag for Spatiotemporal Control of Fluorescence in Living Cells. Walterspiel F, Ugarte-Uribe B, Weidenhausen J, Vincent M, Narayanasamy KK, Dimitriadi A, Khan AUM, Fritsch M, Muller CW, Zimmermann T, Deo C. Angew Chem Int Ed Engl. 2025 Oct 23:e202424955. doi: 10.1002/anie.202424955. 10.1002/anie.202424955 PubMed 41131894