pPB-CAG-dCas9-VPR-pgk-hph
(Plasmid
#233066)
-
PurposePiggybac CRISPRa construct
-
Depositing Lab
-
Depositing OrganizationMax-Delbrueck-Centrum fuer Molekulare Medizin (MDC)
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233066 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 233066-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 233066-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepPB-CAG-3xFLAG-empty-pgk-hph
-
Vector typeCRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-VPR
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer ctacagctcctgggcaacgtgctg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene #48754
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.09.12.612198 for bioRxiv preprint.
DNA (Catalog # 233066-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 233066-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-CAG-dCas9-VPR-pgk-hph was a gift from Markus Landthaler (Addgene plasmid # 233066 ; http://n2t.net/addgene:233066 ; RRID:Addgene_233066) -
For your References section:
Sensitive dissection of a genomic regulatory landscape using bulk and targeted single-cell activation. Vucicevic D, Hsu CW, Lopez Zepeda LS, Burkert M, Hirsekorn A, Bilic I, Kastelic N, Landthaler M, Lacadie SA, Ohler U. Cell Genom. 2025 Oct 8;5(10):100984. doi: 10.1016/j.xgen.2025.100984. Epub 2025 Sep 9. 10.1016/j.xgen.2025.100984 PubMed 40930101
Map uploaded by the depositor.
