Skip to main content

SEAP (Protein secretion reporter) in pLX317
(Plasmid #233290)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 233290 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLX317
  • Total vector size (bp) 10031
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SEAP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1588
  • Promoter E1Fa

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTCTTCCATTTCAGGTGTCGTGAG
  • 3′ sequencing primer GTGGATACGCTGCTTTAATGCCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expresses secreted alkaline phosphatase used for monitoring protein secretion. Please visit https://doi.org/10.1101/2024.01.30.578083 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SEAP (Protein secretion reporter) in pLX317 was a gift from Sefi Rosenbluh (Addgene plasmid # 233290 ; http://n2t.net/addgene:233290 ; RRID:Addgene_233290)
  • For your References section:

    SRP19 and the protein secretion machinery is a targetable vulnerability in cancers with APC loss. Xi X, Liu L, Tuano N, Tailhades J, Mouradov D, Steen J, Sieber O, Cryle M, Nguyen-Dumont T, Segelov E, Rosenbluh J. Proc Natl Acad Sci U S A. 2025 Apr 15;122(15):e2409677122. doi: 10.1073/pnas.2409677122. Epub 2025 Apr 10. 10.1073/pnas.2409677122 PubMed 40208946