-
Purposeexpresses human 7SL RNA, using its own polIII enhancer, and tagged with the self splicing intron neo cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51285 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAluYa5-neo-TET
-
Backbone manufacturerAddgene plasmid 51283
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name7SL RNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)413
-
GenBank IDM20910
-
Entrez GeneRN7SL2 (a.k.a. 7L1C, 7L30.1, 7SL1c, RNSRP2)
- Promoter 7SL upstream pollII enhancer
-
Tag
/ Fusion Protein
- neoTET cassette with a tetrahymena self-splicing intron interrupting the neo gene (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site AatII (not destroyed)
- 5′ sequencing primer M13-pUC-Fwd
- 3′ sequencing primer SV40pro-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
7SL is tagged with the self splicing intron neo cassette such that G418 resistance will be obtained only if retrotransposition occurs.
Primers used for amplification of 7SL:
GGATCCGCCCAGTGTGGGTGTGTCC
GACGTCAAGAGACGGGGTCTCGCTATG
Please note that the cassette is in the reverse orientation within the MCS relative to the full sequence--This has no functional consequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p7SL-neo-TET was a gift from Astrid Roy-Engel (Addgene plasmid # 51285 ; http://n2t.net/addgene:51285 ; RRID:Addgene_51285) -
For your References section:
The RNA polymerase dictates ORF1 requirement and timing of LINE and SINE retrotransposition. Kroutter EN, Belancio VP, Wagstaff BJ, Roy-Engel AM. PLoS Genet. 2009 Apr;5(4):e1000458. doi: 10.1371/journal.pgen.1000458. Epub 2009 Apr 24. 10.1371/journal.pgen.1000458 PubMed 19390602