pC016-gPsp-EGFP_start_codon
(Plasmid
#233613)
-
PurposeExpression of guide RNA targeting the start codon of the EGFP gene for PspCas13b
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 233613 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC016
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting EGFP
-
gRNA/shRNA sequenceTGCTCACCATGGTAGCTTAAGTT
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC016-gPsp-EGFP_start_codon was a gift from Shintaro Iwasaki (Addgene plasmid # 233613 ; http://n2t.net/addgene:233613 ; RRID:Addgene_233613) -
For your References section:
dCas13-mediated translational repression for accurate gene silencing in mammalian cells. Apostolopoulos A, Kawamoto N, Chow SYA, Tsuiji H, Ikeuchi Y, Shichino Y, Iwasaki S. Nat Commun. 2024 Mar 11;15(1):2205. doi: 10.1038/s41467-024-46412-7. 10.1038/s41467-024-46412-7 PubMed 38467613