pPYRMandi-ABI
(Plasmid
#233649)
-
PurposeCellular colocalization assay (PYRMandi/ABI) for the CIP Mandi (mandipropamid)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA5/FRT
- Backbone size w/o insert (bp) 4996
- Total vector size (bp) 8116
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTOMM20-mCherry-PYRMandi-P2A-eGFP-ABI
-
Insert Size (bp)3120
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPYRMandi-ABI was a gift from Richard Wombacher (Addgene plasmid # 233649 ; http://n2t.net/addgene:233649 ; RRID:Addgene_233649) -
For your References section:
Photoactivatable Plant Hormone-Based Chemical Inducers of Proximity for In Vivo Applications. Poschko P, Berrou CM, Pakari K, Ziegler MJ, Kern C, Koch B, Wittbrodt J, Wombacher R. ACS Chem Biol. 2025 Jan 27. doi: 10.1021/acschembio.4c00592. 10.1021/acschembio.4c00592 PubMed 39868662