BIC-Gag-DDX3
(Plasmid
#233687)
-
PurposeExpresses a fusion between the Murine Leukemia Virus Gag polyprotein and the human DDX3 protein to produce virus-like particles loaded with DDX3 and deliver it to target cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233687 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDNA3-like
- Backbone size w/o insert (bp) 6476
- Total vector size (bp) 8486
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDEAD-box helicase 3
-
Alt nameDDX3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2010
-
Entrez GeneDDX3X (a.k.a. CAP-Rf, DBX, DDX14, DDX3, HLP2, MRX102, MRXSSB)
- Promoter hCMV
-
Tag
/ Fusion Protein
- Gag (Murine Leukemia Virus) (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTGACGCGTAGTTCCCTGTATCC
- 3′ sequencing primer CCACCTTCTGATAGGCAGCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BIC-Gag-DDX3 was a gift from Emiliano Ricci (Addgene plasmid # 233687 ; http://n2t.net/addgene:233687 ; RRID:Addgene_233687) -
For your References section:
Non-AUG HIV-1 uORF translation elicits specific T cell immune response and regulates viral transcript expression. Labaronne E, Decimo D, Bertrand L, Guiguettaz L, Sohier TJM, Cluet D, Vivet-Boudou V, Chaves Valadao AL, Dahoui C, Francois P, Hatin I, Lambotte O, Samri A, Autran B, Etienne L, Goujon C, Paillart JC, Namy O, Ramirez BC, Ohlmann T, Moris A, Ricci EP. Nat Commun. 2025 Feb 18;16(1):1706. doi: 10.1038/s41467-025-56772-3. 10.1038/s41467-025-56772-3 PubMed 39966383