pTRE3G_SS-HA-V5-LaccID-CD4 TM_Puro
(Plasmid
#234047)
-
Purposeexpresses LaccID on the mammalian cell surface, dox-inducible lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234047 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLaccID-CD4TM
-
SpeciesSynthetic
- Promoter TRE3G
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcagagctcgtttagtgaaccg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.10.29.620861 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE3G_SS-HA-V5-LaccID-CD4 TM_Puro was a gift from Alice Ting (Addgene plasmid # 234047 ; http://n2t.net/addgene:234047 ; RRID:Addgene_234047) -
For your References section:
Directed evolution of LaccID for cell surface proximity labeling and electron microscopy. Lee SY, Roh H, Gonzalez-Perez D, Mackey MR, Hoces D, McLaughlin CN, Lin C, Adams SR, Nguyen K, Kim KY, Luginbuhl DJ, Luo L, Udeshi ND, Carr SA, Hernandez-Lopez RA, Ellisman MH, Alcalde M, Ting AY. Nat Chem Biol. 2025 Aug 1. doi: 10.1038/s41589-025-01973-6. 10.1038/s41589-025-01973-6 PubMed 40751001