pSM.wrmScarlet1-10::SL2::GFP1-10
(Plasmid
#234318)
-
PurposeFor the expression of wrmScarlet1-10 and GFP1-10 in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 234318 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSM
-
Backbone manufacturerCori Bargmann's lab
- Backbone size w/o insert (bp) 3600
- Total vector size (bp) 5023
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namewrmScarlet1-10::SL2::GFP1-10
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)870
-
GenBank ID
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgaccatgattacgcc
- 3′ sequencing primer gttgaagagtaattggacttag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was generated by replacing the GFP sequence in the pSM (eGFP_unc-54 utr) plasmid with wrmScarlet1-10::SL2::GFP1-10.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSM.wrmScarlet1-10::SL2::GFP1-10 was a gift from Kota Mizumoto (Addgene plasmid # 234318 ; http://n2t.net/addgene:234318 ; RRID:Addgene_234318) -
For your References section:
A modular system to label endogenous presynaptic proteins using split fluorophores in C. elegans. Kurashina M, Snow AW, Mizumoto K. Genetics. 2024 Dec 22:iyae214. doi: 10.1093/genetics/iyae214. 10.1093/genetics/iyae214 PubMed 39708832