Skip to main content

pSM.wrmScarlet1-10::SL2::GFP1-10
(Plasmid #234318)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234318 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSM
  • Backbone manufacturer
    Cori Bargmann's lab
  • Backbone size w/o insert (bp) 3600
  • Total vector size (bp) 5023
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    wrmScarlet1-10::SL2::GFP1-10
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    870
  • GenBank ID

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atgaccatgattacgcc
  • 3′ sequencing primer gttgaagagtaattggacttag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was generated by replacing the GFP sequence in the pSM (eGFP_unc-54 utr) plasmid with wrmScarlet1-10::SL2::GFP1-10.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSM.wrmScarlet1-10::SL2::GFP1-10 was a gift from Kota Mizumoto (Addgene plasmid # 234318 ; http://n2t.net/addgene:234318 ; RRID:Addgene_234318)
  • For your References section:

    A modular system to label endogenous presynaptic proteins using split fluorophores in C. elegans. Kurashina M, Snow AW, Mizumoto K. Genetics. 2024 Dec 22:iyae214. doi: 10.1093/genetics/iyae214. 10.1093/genetics/iyae214 PubMed 39708832