Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGreenPuro-shRNA-Stx3S-C4
(Plasmid #99742)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99742 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGreenPuro
  • Backbone manufacturer
    System Biosciences Inc.
  • Backbone size w/o insert (bp) 7861
  • Total vector size (bp) 7882
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin ; CopGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shRNA against Stx3S
  • gRNA/shRNA sequence
    ggaagaaactgatttcactcc
  • Species
    H. sapiens (human)
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AATGTCTTTGGATTTGGGAATCTTAT
  • 3′ sequencing primer TGGTCTAACCAGAGAGACCCAGTA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGreenPuro-shRNA-Stx3S-C4 was a gift from Thomas Weimbs (Addgene plasmid # 99742 ; http://n2t.net/addgene:99742 ; RRID:Addgene_99742)
  • For your References section:

    Soluble syntaxin 3 functions as a transcriptional regulator. Giovannone AJ, Winterstein C, Bhattaram P, Reales E, Low SH, Baggs JE, Xu M, Lalli MA, Hogenesch JB, Weimbs T. J Biol Chem. 2018 Apr 13;293(15):5478-5491. doi: 10.1074/jbc.RA117.000874. Epub 2018 Feb 23. 10.1074/jbc.RA117.000874 PubMed 29475951