Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSIF-H1-hpolb-copGFP
(Plasmid #23256)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 23256 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSIF-H1-copGFP
  • Backbone manufacturer
    SIB
  • Backbone size w/o insert (bp) 6400
  • Vector type
    Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNA polymerase beta shRNA
  • Alt name
    POLB shRNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    23
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

shRNA oligo sequence is - 5’-ctggcagacgcaacctaatgggacttcctgtcagatcctattgggttgtgtctgccagttttt

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIF-H1-hpolb-copGFP was a gift from Robert Sobol (Addgene plasmid # 23256 ; http://n2t.net/addgene:23256 ; RRID:Addgene_23256)
  • For your References section:

    Bioenergetic Metabolites Regulate Base Excision Repair-Dependent Cell Death in Response to DNA Damage. Tang JB, Goellner EM, Wang XH, Trivedi RN, St Croix CM, Jelezcova E, Svilar D, Brown AR, Sobol RW. Mol Cancer Res. 2010 Jan 12. ():. 10.1158/1541-7786.MCR-09-0411 PubMed 20068071