pSIF-H1-hpolb-copGFP
(Plasmid
#23256)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 23256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSIF-H1-copGFP
-
Backbone manufacturerSIB
- Backbone size w/o insert (bp) 6400
-
Vector typeLentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDNA polymerase beta shRNA
-
Alt namePOLB shRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)23
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer N/A (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA oligo sequence is - 5’-ctggcagacgcaacctaatgggacttcctgtcagatcctattgggttgtgtctgccagttttt
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIF-H1-hpolb-copGFP was a gift from Robert Sobol (Addgene plasmid # 23256 ; http://n2t.net/addgene:23256 ; RRID:Addgene_23256) -
For your References section:
Bioenergetic Metabolites Regulate Base Excision Repair-Dependent Cell Death in Response to DNA Damage. Tang JB, Goellner EM, Wang XH, Trivedi RN, St Croix CM, Jelezcova E, Svilar D, Brown AR, Sobol RW. Mol Cancer Res. 2010 Jan 12. ():. 10.1158/1541-7786.MCR-09-0411 PubMed 20068071