Skip to main content
Addgene

pCMV-eGFP-uTEV3
(Plasmid #234320)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234320 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 3805
  • Total vector size (bp) 5284
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP-uTEV3
  • Species
    Synthetic
  • Insert Size (bp)
    1479
  • Mutation
    Mutations respective to the wild type TEV: S219V mutation improves stability, I138T/S153N/T180A mutations improve activity. Last 6 amino acids from TEV were deleted (237-242)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV: caacgggactttccaaaatgtcgtaac
  • 3′ sequencing primer PolyA: CAGTGGGAGTGGCACCTTCCAGGGTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-eGFP-uTEV3 was a gift from Mateo Sánchez (Addgene plasmid # 234320 ; http://n2t.net/addgene:234320 ; RRID:Addgene_234320)

  • For your References section:

    Mechanically knocking out titin reveals protein tension loss as a trigger of muscle disease. Silva-Rojas R, Vicente N, Gavilán-Herrera M, Labrador-Cantarero V, Sicilia J, Giménez-Sáez O, Dumitru AC, Sánchez MI, Gato-Vilaseca M, Velázquez-Carreras D, López JA, Vázquez J, Herrero-Galán E, López-Unzu MA, Pricolo MR, Alegre-Cebollada J. Nat. Biomed. Eng (2025). 10.1038/s41551-025-01403-x
Related items: