Skip to main content
Addgene

pCMV-eGFP-uTEV3
(Plasmid #234320)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234320 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 3805
  • Total vector size (bp) 5284
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP-uTEV3
  • Species
    Synthetic
  • Insert Size (bp)
    1479
  • Mutation
    Mutations respective to the wild type TEV: S219V mutation improves stability, I138T/S153N/T180A mutations improve activity. Last 6 amino acids from TEV were deleted (237-242)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV: caacgggactttccaaaatgtcgtaac
  • 3′ sequencing primer PolyA: CAGTGGGAGTGGCACCTTCCAGGGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-eGFP-uTEV3 was a gift from Mateo Sánchez (Addgene plasmid # 234320 ; http://n2t.net/addgene:234320 ; RRID:Addgene_234320)
  • For your References section:

    Mechanically knocking out titin reveals protein tension loss as a trigger of muscle disease. Silva-Rojas R, Vicente N, Gavilan-Herrera M, Labrador-Cantarero V, Sicilia J, Gimenez-Saez O, Dumitru AC, Sanchez MI, Gato-Vilaseca M, Velazquez-Carreras D, Lopez JA, Vazquez J, Herrero-Galan E, Lopez-Unzu MA, Pricolo MR, Alegre-Cebollada J. Nat Biomed Eng. 2025 Jun 5. doi: 10.1038/s41551-025-01403-x. 10.1038/s41551-025-01403-x PubMed 40473933