VWF-pHluorin-mRFP
(Plasmid
#234367)
-
PurposeVon Willebrand factor fused in tandem to superecliptic pHluorin and inserted into pmRFP1-N1 vector from Addgene (Plasmid No: 54635)/Monitoring of WPB pH, Visualization of WPB exocytosis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 234367 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepmRFP1-N1
-
Backbone manufacturerRobert Campbell & Michael Davidson & Roger Tsien (Addgene plasmid # 54635)
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVon Willebrand factor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)8441
-
Entrez GeneVWF (a.k.a. F8VWF, VWD)
-
Tag
/ Fusion Protein
- pHluorin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CCTCTACAAATGTGGTATGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byVWF-pHluorin was obtained by replacing mRFP in a VWF-mRFP plasmid, which was kindly provided by Tom Carter (St. George´s University of London, UK) [Babich et al. 2008 Selective release of molecules from Weibel-Palade bodies during a lingering kiss, Hannah et al. 2005 Differential kinetics of cell surface loss of von Willebrand factor and its propolypeptide after secretion from Weibel-palade bodies in living human endothelial cells], with superecliptic pHluorin (courtesy of Anja Biesemann, Institute of Medical Biochemistry, University of Muenster).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VWF-pHluorin-mRFP was a gift from Volker Gerke (Addgene plasmid # 234367 ; http://n2t.net/addgene:234367 ; RRID:Addgene_234367) -
For your References section:
Acidification of endothelial Weibel-Palade bodies is mediated by the vacuolar-type H+-ATPase. Terglane J, Menche D, Gerke V. PLoS One. 2022 Jun 29;17(6):e0270299. doi: 10.1371/journal.pone.0270299. eCollection 2022. 10.1371/journal.pone.0270299 PubMed 35767558