Skip to main content

VWF-pHluorin-mRFP
(Plasmid #234367)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234367 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmRFP1-N1
  • Backbone manufacturer
    Robert Campbell & Michael Davidson & Roger Tsien (Addgene plasmid # 54635)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Von Willebrand factor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    8441
  • Entrez Gene
    VWF (a.k.a. F8VWF, VWD)
  • Tag / Fusion Protein
    • pHluorin (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CCTCTACAAATGTGGTATGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    VWF-pHluorin was obtained by replacing mRFP in a VWF-mRFP plasmid, which was kindly provided by Tom Carter (St. George´s University of London, UK) [Babich et al. 2008 Selective release of molecules from Weibel-Palade bodies during a lingering kiss, Hannah et al. 2005 Differential kinetics of cell surface loss of von Willebrand factor and its propolypeptide after secretion from Weibel-palade bodies in living human endothelial cells], with superecliptic pHluorin (courtesy of Anja Biesemann, Institute of Medical Biochemistry, University of Muenster).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VWF-pHluorin-mRFP was a gift from Volker Gerke (Addgene plasmid # 234367 ; http://n2t.net/addgene:234367 ; RRID:Addgene_234367)
  • For your References section:

    Acidification of endothelial Weibel-Palade bodies is mediated by the vacuolar-type H+-ATPase. Terglane J, Menche D, Gerke V. PLoS One. 2022 Jun 29;17(6):e0270299. doi: 10.1371/journal.pone.0270299. eCollection 2022. 10.1371/journal.pone.0270299 PubMed 35767558