FEOX-PBCS-TBF2- MC2
(Plasmid
#234406)
-
PurposeTool for genetically encoded fluorescent biosensor of cellular iron microenvironment
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonecustom
- Backbone size w/o insert (bp) 3871
- Total vector size (bp) 8023
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFEOX1 CONTROL
-
Alt namemCherry
-
SpeciesSynthetic
- Promoter hpgk
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site None (destroyed during cloning)
- 3′ cloning site None (destroyed during cloning)
- 5′ sequencing primer TGTTCCGCATTCTGCAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFEOX
-
SpeciesSynthetic
- Promoter EF1-alpha
-
Tag
/ Fusion Protein
- mTagBFP2 (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site None (destroyed during cloning)
- 3′ cloning site None (destroyed during cloning)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FEOX-PBCS-TBF2- MC2 was a gift from Carolyn Sangokoya (Addgene plasmid # 234406 ; http://n2t.net/addgene:234406 ; RRID:Addgene_234406) -
For your References section:
The genetically encoded biosensor FEOX is a molecular gauge for cellular iron environment dynamics at single cell resolution. Sangokoya C. Sci Rep. 2025 Oct 21;15(1):36596. doi: 10.1038/s41598-025-20428-5. 10.1038/s41598-025-20428-5 PubMed 41120533