Skip to main content

pDisplay-CMV-GRAB_LoX3-1.0
(Plasmid #234650)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234650 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDisplay
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6546
  • Total vector size (bp) 8631
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GPCR activation based chemokine CXCL9-11 sensor GRAB_LoX3-1.0
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2085
  • Entrez Gene
    CXCR3 (a.k.a. CD182, CD183, CKR-L2, CMKAR3, GPR9, IP10-R, Mig-R, MigR)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGGCGGTAGGCGTGTA
  • 3′ sequencing primer GGTTGTGGCCATATTATCATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDisplay-CMV-GRAB_LoX3-1.0 was a gift from Miao Jing (Addgene plasmid # 234650 ; http://n2t.net/addgene:234650 ; RRID:Addgene_234650)
  • For your References section:

    Spatiotemporal dynamics of CXCL10 encode contextual immune information revealed by the genetically encoded fluorescent sensor. Xi F, Wang C, Wang Y, Luan P, Chen Y, Tan L, Shang N, Gao X, Chen D, Guo Q, Chen T, Jing M. Immunity. 2025 Sep 9;58(9):2320-2335.e9. doi: 10.1016/j.immuni.2025.07.005. Epub 2025 Aug 15. 10.1016/j.immuni.2025.07.005 PubMed 40818452