pDisplay-CMV-GRAB_LoX3-1.0
(Plasmid
#234650)
-
PurposeThis plasmid encodes a genetically encoded fluorescent biosensor based on human CXCR3 for chemokine CXCL9-11 detection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234650 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDisplay
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6546
- Total vector size (bp) 8631
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPCR activation based chemokine CXCL9-11 sensor GRAB_LoX3-1.0
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2085
-
Entrez GeneCXCR3 (a.k.a. CD182, CD183, CKR-L2, CMKAR3, GPR9, IP10-R, Mig-R, MigR)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGGCGGTAGGCGTGTA
- 3′ sequencing primer GGTTGTGGCCATATTATCATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisplay-CMV-GRAB_LoX3-1.0 was a gift from Miao Jing (Addgene plasmid # 234650 ; http://n2t.net/addgene:234650 ; RRID:Addgene_234650) -
For your References section:
Spatiotemporal dynamics of CXCL10 encode contextual immune information revealed by the genetically encoded fluorescent sensor. Xi F, Wang C, Wang Y, Luan P, Chen Y, Tan L, Shang N, Gao X, Chen D, Guo Q, Chen T, Jing M. Immunity. 2025 Sep 9;58(9):2320-2335.e9. doi: 10.1016/j.immuni.2025.07.005. Epub 2025 Aug 15. 10.1016/j.immuni.2025.07.005 PubMed 40818452