pUE001-Dendra2Hfx
(Plasmid
#234669)
-
Purposeencodes Dendra2Hfx in Haloferax volcanii under the tryptophan inducible p.tna promoter, trpA, ampR, shuttle vector for E.coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUE001
- Backbone size w/o insert (bp) 8075
- Total vector size (bp) 8768
-
Vector typeArchaeal expression in Haloferax volcanii
-
Selectable markerstrpA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsgrowth in Haloferax volcannii: 42 - 45 °C growth temperature
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDendra2Hfx
-
SpeciesSynthetic
-
Insert Size (bp)693
- Promoter p.tna
-
Tag
/ Fusion Protein
- Dendra2Hfx
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGTGAGCGAGGAAGCGGAAG
- 3′ sequencing primer GTGGCGAGAAAGGAAGGGAAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is a shuttle vector for replication in E.coli but protein expression and replication in the archaeon Haloferax volcanii
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUE001-Dendra2Hfx was a gift from Ulrike Endesfelder (Addgene plasmid # 234669 ; http://n2t.net/addgene:234669 ; RRID:Addgene_234669) -
For your References section:
A novel expression system for imaging single-molecule fluorescence in Haloferax volcanii WR806 enables visualization of altered Cas1 dynamics during UV-induced DNA damage response. Schrage PR, Afonina U, Wörtz J, Marchfelder A, Martens KJA, Sáenz JP, Endesfelder U. μLife