A24M04 mIgM heavy chain-pFEEKW
(Plasmid
#234809)
-
PurposeExpress membrane form of IgM heavy chain containing the VH region of the monoclonal antibody, A24M04, specific for human papilloma virus16 L1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234809 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFEEKW (VRC9736)
- Backbone size w/o insert (bp) 8846
- Total vector size (bp) 10697
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameA24M04 membrane IgM heavy chain
-
Alt nameA24M04 mIgM HC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1851
-
GenBank IDPV067159
-
Entrez GeneIGHM (a.k.a. AGM1, MU, VH)
- Promoter EEK promoter
Cloning Information
- Cloning method Other
- 5′ sequencing primer seq 1F: TTACAGTTGACCCGTACGTG (Vector)
- 3′ sequencing primer seq1R: ATGGTCTGCTTCAGTGGAGA, seq2R: TCTGGGATTGCCAAAGAAGC), seq3R: TAGAGATATCAGAATTGTTC), seq4R: TTCCCGTATGGCTTTCATTT (Vector)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDenise A. Galloway, Human Biology Division, Fred Hutchinson Cancer Research Center, Seattle, WA 98109
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
VH and VL nucleotide sequences of A24M04, an IgG monoclonal antibody clone were obtained from Dr. Galloway's lab and we constructed this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
A24M04 mIgM heavy chain-pFEEKW was a gift from Susan Pierce (Addgene plasmid # 234809 ; http://n2t.net/addgene:234809 ; RRID:Addgene_234809) -
For your References section:
In the activation of HPV-specific human B cells HPV-VLP vaccines mimic membrane-associated antigens. Torgbor C, Sohn H, Dizon BLP, Mutic EC, George R, Kwak K, Akkaya M, Ulker EB, Traver M, Brzostowski J, Galloway DA, Thompson CD, Cuburu N, Schiller JT, Pierce SK. Proc Natl Acad Sci U S A. 2025 Mar 11;122(10):e2414514122. doi: 10.1073/pnas.2414514122. Epub 2025 Mar 3. 10.1073/pnas.2414514122 PubMed 40030014