Skip to main content

VN1263 pB2Hws_v28_pLWeakRBS_TIR371_cI-Asf1B+rpoA-IP1_Ddcm_WeaKRBS_TIR51_KanR
(Plasmid #235115)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235115 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAC
  • Backbone size w/o insert (bp) 5639
  • Vector type
    Bacterial Expression, Synthetic Biology ; Quantitative bacterial two-hybrid (qB2H)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    SB39 (Addgene #235121)
  • Growth instructions
    Resistant to kanamycin (dependent on the interaction strength)
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Asf1B
  • Alt name
    Anti-silencing function protein 1 homolog B
  • Alt name
    CCG1-interacting factor A-II
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    483
  • Entrez Gene
    ASF1B (a.k.a. CIA-II)
  • Promoter LtetO

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Acc65I (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer GATCAGGGATAGCGGTCAGG
  • 3′ sequencing primer TCCCCGTGGAGGTAATAATTGAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    IP1
  • Species
    Synthetic
  • Insert Size (bp)
    72
  • Promoter lpp+lacUV5
  • Tag / Fusion Protein
    • cI_E34P-rpoA (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GAACAGCGTACCGACCTGGAC
  • 3′ sequencing primer AAGTTGGCCCAGGGCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VN1263 pB2Hws_v28_pLWeakRBS_TIR371_cI-Asf1B+rpoA-IP1_Ddcm_WeaKRBS_TIR51_KanR was a gift from Oscar Ramos (Addgene plasmid # 235115 ; http://n2t.net/addgene:235115 ; RRID:Addgene_235115)
  • For your References section:

    Optimized quantitative bacterial two-hybrid (qB2H) for protein-protein interaction assessment. Guyot A, Maillard E, Ferreira-Pinto K, Plancon-Arnould L, Nadaradjane AA, Ochsenbein F, Guerois R, Martin L, Ramos OHP. bioRxiv 2025.10.29.680610 10.1101/2025.10.29.680610