pLKO.1-puro-USP7-sh5
(Plasmid
#235528)
-
PurposeshRNA against human USP7
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 235528 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO.1-puro
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUSP7
-
gRNA/shRNA sequenceCGTGGTGTCAAGGTGTACTAA
-
SpeciesH. sapiens (human)
-
Entrez GeneUSP7 (a.k.a. C16DELp13.2, DEL16P13.2, HAFOUS, HAUSP, TEF1)
Cloning Information
- Cloning method Other
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-puro-USP7-sh5 was a gift from Nicolas Manel (Addgene plasmid # 235528 ; http://n2t.net/addgene:235528 ; RRID:Addgene_235528) -
For your References section:
Centromeric DNA amplification triggered by viral proteins activates nuclear cGAS. Lahaye X, Tran Van P, Chakraborty C, Shmakova A, Cao NTB, Ferran H, Ait-Mohamed O, Maurin M, Waterfall JJ, Kaufer BB, Fischer P, Hennig T, Dolken L, Lomonte P, Fachinetti D, Manel N. Cell. 2025 May 29:S0092-8674(25)00556-2. doi: 10.1016/j.cell.2025.05.008. 10.1016/j.cell.2025.05.008 PubMed 40460826